SubtiBank SubtiBank
tkt

tkt

transketolase
locus
BSU_17890
pI
4.80
mw
72.16 kDa
protein length
667 aa Sequence Blast
gene length
2004 bp Sequence Blast
function
pentose phosphate pathway
product
transketolase
essential
no
ec
2.2.1.1
synonyms
tktA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.3|Pentose phosphate pathway]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    1,919,861 1,921,864

    The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate --> aldehydo-D-ribose 5-phosphate + D-xylulose 5-phosphate (according to UniProt)
  • Protein family

  • transketolase family (with [protein|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|Dxs], according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • [SW|Cofactors]

  • thiamine pyrophosphate
  • Structure

  • [PDB|3HYL], from B. anthracis
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]
    description
    [Pubmed|9068642]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BS4530 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
  • BKK17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
  • Expression vectors

  • pGP94 (N-terminal Strep-tag, for [SW|SPINE], expression in B. subtilis, in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP820, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1406 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 9924800,25267444,24929114
  • Original publications

  • 14651647,16493705,19603213,9068642,16143417,15375635,19193632,23568212,23965678,15378759