SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcriptional regulator ([SW|MarR family])
16.72 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    2,288,194 2,288,619

    The protein

    Protein family

  • [SW|MarR family]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 4-139) (according to UniProt)
  • Structure

  • [PDB|2RDP] (from Geobacillus stearothermophilus, 25% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A891 (ypoP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE21700 ([gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTGAACCTCCATT, downstream forward: _UP4_TGAAAAAAAGCACATACCGA
  • BKK21700 ([gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTGAACCTCCATT, downstream forward: _UP4_TGAAAAAAAGCACATACCGA