SubtiBank SubtiBank
ypoP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypoP

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_21700
pI
9.26
mw
16.72 kDa
protein length
141 aa Sequence Blast
gene length
426 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,288,194 2,288,619

    The protein

    Protein family

  • [SW|MarR family]
  • Structure

  • [PDB|2RDP] (from Geobacillus stearothermophilus, 25% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A891 (ypoP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/891 NBRP B. subtilis, Japan]
  • BKE21700 ([gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTGAACCTCCATT, downstream forward: _UP4_TGAAAAAAAGCACATACCGA
  • BKK21700 ([gene|0021EF5F0934B4D6A1A52C5B34B36D135E6D8CE8|ypoP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTTGTGAACCTCCATT, downstream forward: _UP4_TGAAAAAAAGCACATACCGA