SubtiBank SubtiBank
niaP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

niaP

nicotinate transporter
locus
BSU_02950
pI
9.50
mw
43.55 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
uptake of niacin
product
nicotinate transporter
essential
no
synonyms
yceI

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.7|Transporter for cofactors]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    317,725 318,927

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • [SW|major facilitator superfamily] [Pubmed|18276644]
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • [SW|Domains]

  • 10 membrane-spanning domains [Pubmed|18276644]
  • Structure

  • [PDB|4J05] (from ''P. indica'', 24% identity) [Pubmed|23542591]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|0037A6808E75C2A2E207A7005EFDA71FCE90BAD8|niaP]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|18276644], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|18276644]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C047 (yceI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2045 NBRP B. subtilis, Japan]
  • BKE02950 ([gene|0037A6808E75C2A2E207A7005EFDA71FCE90BAD8|niaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCAACACCTCTGATA, downstream forward: _UP4_TAGGAAAAGCACCTCTTAAA
  • BKK02950 ([gene|0037A6808E75C2A2E207A7005EFDA71FCE90BAD8|niaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCAACACCTCTGATA, downstream forward: _UP4_TAGGAAAAGCACCTCTTAAA
  • References

    Reviews

  • 21953179
  • Original publications

  • 18763711,18276644,23980836,22383849,23542591