SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein
15.60 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,047,593 3,048,015

    Phenotypes of a mutant

  • inactivation of ''[gene|00A42FDB559BE2647CD682180420A435E2E7035F|ytxG]'' reduces sporulation efficiency to 39.6% that of wild type cells; aberrant membrane morphologies [Pubmed|26735940]
  • The protein

    Protein family

  • UPF0478 family (single member, according to UniProt)
  • [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8733232,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|8733232], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|8733232,11544224]
  • view in new tab

    Biological materials


  • MGNA-B529 (ytxG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29780 ([gene|00A42FDB559BE2647CD682180420A435E2E7035F|ytxG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAACCTCCTTGCTG, downstream forward: _UP4_TAAGAGAAAAAAATACTAAG
  • BKK29780 ([gene|00A42FDB559BE2647CD682180420A435E2E7035F|ytxG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAACCTCCTTGCTG, downstream forward: _UP4_TAAGAGAAAAAAATACTAAG
  • References

  • 11544224,8733232,18763711,26735940