SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glucomannan-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW 1.2.2|PTS]
11.30 kDa
protein length
103 aa Sequence Blast
gene length
312 bp Sequence Blast
glucomannan uptake and phosphorylation
glucomannan-specific lichenan-specific [category|SW 1.2.2|PTS], EIIB component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucomannan]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    626,622 626,933

    The protein

    Catalyzed reaction/ biological activity

  • D-cellobiose + Nπ-phospho-L-histidyl-[protein] --> 6-phospho-β-D-glucosyl-(1→4)-D-glucose + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, lactose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|LicB]
  • [SW|Domains]

  • [SW|PTS EIIB domain] type-3 (aa 1-103) (according to UniProt)
  • Structure

  • [PDB|4MGE] (from B. anthracis, 46% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials


  • MGNA-C188 (ydhM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05810 ([gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGCTATCCCCCCTGTT, downstream forward: _UP4_TTGTCCTTAATGGTGAATCA
  • BKK05810 ([gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGCTATCCCCCCTGTT, downstream forward: _UP4_TTGTCCTTAATGGTGAATCA
  • References

  • 18177310,10627040,22900538,20817675