SubtiBank SubtiBank
gmuB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gmuB

glucomannan-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW 1.2.2|PTS]
locus
BSU_05810
pI
4.72
mw
11.30 kDa
protein length
103 aa Sequence Blast
gene length
312 bp Sequence Blast
function
glucomannan uptake and phosphorylation
product
glucomannan-specific lichenan-specific [category|SW 1.2.2|PTS], EIIB component
essential
no
synonyms
ydhM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.25|Utilization of glucomannan]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    Coordinates
    626,622 626,933

    The protein

    Catalyzed reaction/ biological activity

  • D-cellobiose + Nπ-phospho-L-histidyl-[protein] --> 6-phospho-β-D-glucosyl-(1→4)-D-glucose + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, lactose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|LicB]
  • [SW|Domains]

  • [SW|PTS EIIB domain] type-3 (aa 1-103) (according to UniProt)
  • Structure

  • [PDB|4MGE] (from B. anthracis, 46% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
    description
    [Pubmed|18177310]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C188 (ydhM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2186 NBRP B. subtilis, Japan]
  • BKE05810 ([gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGCTATCCCCCCTGTT, downstream forward: _UP4_TTGTCCTTAATGGTGAATCA
  • BKK05810 ([gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGCTATCCCCCCTGTT, downstream forward: _UP4_TTGTCCTTAATGGTGAATCA
  • References

  • 18177310,10627040,22900538,20817675