SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


component of the SpoIIIA-SpoIIQ type III secretion system residing in the forespore membrane, required for SigG activation
23.58 kDa
protein length
218 aa Sequence Blast
gene length
654 bp Sequence Blast
activation of SigG, forespore encasement by the spore coat
part of the transmembrane channel linking the mother cell and the forespore

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,532,353 → 2,533,009

    Phenotype of a mutant

  • reduced sporulation efficiency (1 to 10% compared to wild type) [Pubmed|26735940]
  • the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe sporulation defect (0.001%) [Pubmed|26735940]
  • block of sporulation after engulfment
  • The protein

    Catalyzed reaction/ biological activity

  • required for forespore encasement by the spore coat [Pubmed|22171814]
  • Structure

  • [PDB|3UZO]; [PDB|3TUF] (the [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]-[protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] pore forming complex) [Pubmed|22431604,22431613]
  • [SW|Localization]

  • membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]) [Pubmed|22431604,22431613,22171814,18485064]
  • proper recruitment to the sporulation septum on the mother cell side requires [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|23834622]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab



  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab



  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab

    Biological materials


  • BKE24360 (Δ[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGC
  • BKK24360 (Δ[gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGC
  • Labs working on this gene/protein

  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 23944268,25105965
  • Original publications

  • 15752199,18485064,15574594,18812514,1766372,17693505,19609349,17121846,21097616,22431613,22171814,23834622,22431604,23859254,25356555,26735940,27381174,27681621