SubtiBank SubtiBank
pfeT [2019-01-04 10:32:38]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pfeT [2019-01-04 10:32:38]

Fe2+ efflux pump, P1B4-type ATPase, protects the cell against iron intoxication
locus
BSU13850
pI
4.93
mw
68.39 kDa
protein length
637 aa Sequence Blast
gene length
1911 bp Sequence Blast
function
protection against toxic iron
product
Fe2+ efflux pump
essential
no
ec
3.6.3.5
synonyms
ykvW,zosA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.6|Iron export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,451,371 → 1,453,284

    Phenotypes of a mutant

  • sensitivity to iron, this can be suppressed by low levels of Mn2+ [Pubmed|26261021]
  • reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
  • reduced expression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], control is exerted at the post-transcriptional level and can be rescued by the addition of excess zinc [Pubmed|21813502]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + Zn2(In) = ADP phosphate Zn2 (Out) (according to Swiss-Prot) P-type zinc-transporting ATPase [Pubmed|12180919]
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5BC6B02770E74FF6D453742832574A87BB2369B8|CadA], [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA]
  • Structure

  • [PDB|4UMV] (zinc transporter from Shigella sonnei, 39% identity) [pubmed|25132545]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]
    description
    [Pubmed|12180919]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12180919], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|31988078,22194458,12180919], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: activation, [pubmed|31988078], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|D0982500E52577D52FADF775C0E512A4B9657B79|AhpC]) [Pubmed|12180919]
  • induced by oxidative stress ([protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]) [pubmed|31988078]
  • induced by iron excess ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|31988078,22194458]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA] and [gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B329 (ykvW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1328 NBRP B. subtilis, Japan]
  • BKE13850 (Δ[gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAATTCTCCTCTCT, downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
  • BKK13850 (Δ[gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAATTCTCCTCTCT, downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
  • References

    Reviews

  • 28604884
  • Original publications

  • 14563870,12426338,12486061,12180919,12779235,21813502,12180919,12180919,20525796,26261021,26566138,25132545,22194458