SubtiBank SubtiBank
pfeT [2017-10-05 09:10:28]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pfeT [2017-10-05 09:10:28]

Fe(II) efflux pump, P1B4 -type ATPase, protects the cell against iron intoxication
68.39 kDa
protein length
637 aa Sequence Blast
gene length
1911 bp Sequence Blast
protection against toxic iron
Fe(II) efflux pump

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Iron export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,451,371 → 1,453,284

    Phenotypes of a mutant

  • sensitivity to iron, this can be suppressed by low levels of Mn(II) [Pubmed|26261021]
  • reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
  • reduced expression of ''[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]'', control is exerted at the post-transcriptional level and can be rescued by the addition of excess zinc [Pubmed|21813502]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP H2O Zn2 (In) = ADP phosphate Zn2 (Out) (according to Swiss-Prot) P-type zinc-transporting ATPase [Pubmed|12180919]
  • Protein family

  • Type IB subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|4UMV] (zinc transporter from Shigella sonnei, 39% identity) [pubmed|25132545]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12180919], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|31988078,22194458,12180919], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: activation, [pubmed|31988078], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|D0982500E52577D52FADF775C0E512A4B9657B79|AhpC]) [Pubmed|12180919]
  • induced by oxidative stress ([protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]) [pubmed|31988078]
  • induced by iron excess ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|31988078,22194458]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|0B299F9459023306FA91298A6162A09E4A87C3B2|stoA] and [gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT] [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B329 (ykvW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13850 (Δ[gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAATTCTCCTCTCT, downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
  • BKK13850 (Δ[gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAATTCTCCTCTCT, downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
  • References

  • 14563870,12426338,12486061,12180919,12779235,21813502,12180919,12180919,20525796,26261021,26566138,25132545