SubtiBank SubtiBank
yjfA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yjfA

unknown
locus
BSU_12110
pI
9.49
mw
16.74 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,282,571 1,283,044

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|01AC4E8F76170E04A215C20EB6E833D3661EA49F|yjfA]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12480901,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A346 (yjfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/346 NBRP B. subtilis, Japan]
  • BKE12110 ([gene|01AC4E8F76170E04A215C20EB6E833D3661EA49F|yjfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTATGACCTCCTTAAT, downstream forward: _UP4_TAAATAGAAAAAAGGCTGTC
  • BKK12110 ([gene|01AC4E8F76170E04A215C20EB6E833D3661EA49F|yjfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTATGACCTCCTTAAT, downstream forward: _UP4_TAAATAGAAAAAAGGCTGTC
  • References

  • 18957862,12480901,15699190