SubtiBank SubtiBank
spoVT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVT

transcription activator and repressor of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]-dependent genes
locus
BSU_00560
pI
4.68
mw
19.60 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
regulation of forespore gene expression
product
transcriptional regulator
essential
no
synonyms
yabL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    64,099 64,635

    The protein

    Paralogous protein(s)

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]:
  • [SW|Domains]

  • [SW|SpoVT-AbrB domain] (aa 5-51) (according to UniProt)
  • Structure

  • [PDB|2W1R] (full-length), [PDB|2W1T] (C-terminal domain) [PDB|2RO5] (recognition domain)
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]
    description
    [Pubmed|8755877]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8755877], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in the forespore ([protein|search|SigG]) [Pubmed|8755877]
  • view in new tab

    genes
    [gene|C595D32D98723E93AF26B5C864FD61AF4739E069|fin]-[gene|AD1F39823ABCE2A222259B879513752942C59590|mfd]-[gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE00560 ([gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGGTGCCTCTCTTT, downstream forward: _UP4_TAGGTCTTATTCCTTTCTTC
  • BKK00560 ([gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGGTGCCTCTCTTT, downstream forward: _UP4_TAGGTCTTATTCCTTTCTTC
  • References

    Reviews

  • 31350897
  • Original Publications

  • 16497325,18996130,15063493,8755877,16479537,16159768,22522895,15980461,27790204