SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to L-amino acid oxidase
50.47 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,074,439 2,075,779

    The protein

    Catalyzed reaction/ biological activity

  • L-α-amino acid + H2O + O2 --> 2-oxocarboxylate + H2O2 + NH4+(according to UniProt)
  • Protein family

  • flavin monoamine oxidase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3KVE] (from Vipera ammodytes 35% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A311 (yobN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19020 ([gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTGGAGGCACCTCT, downstream forward: _UP4_TAGATCATGCTCACATCTTG
  • BKK19020 ([gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTGGAGGCACCTCT, downstream forward: _UP4_TAGATCATGCTCACATCTTG