SubtiBank SubtiBank
xpt
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xpt

xanthine phosphoribosyltransferase
locus
BSU_22070
pI
5.84
mw
20.89 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
purine salvage and interconversion
product
xanthine phosphoribosyltransferase
essential
no
ec
2.4.2.22
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • Gene

    Coordinates
    2,319,440 2,320,024

    The protein

    Catalyzed reaction/ biological activity

  • diphosphate + XMP --> 5-phospho-α-D-ribose 1-diphosphate + xanthine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Structure

  • [PDB|1Y0B], [PDB|2FXV] (complex with GMP), [PDB|1Y27] (the riboswitch in complex with guanine)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]-[gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]
    description
    [Pubmed|9098051]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, [SW|riboswitch] [Pubmed|9098051,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • induced in the absence of guanine ([SW|G-box]) [Pubmed|12787499]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A870 (xpt::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/870 NBRP B. subtilis, Japan]
  • BKE22070 ([gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGTCTACCTCCGTTA, downstream forward: _UP4_TCCTTCGTACAGGAGGTTCA
  • BKK22070 ([gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGTCTACCTCCGTTA, downstream forward: _UP4_TCCTTCGTACAGGAGGTTCA
  • lacZ fusion

  • pGP430 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16716072,9098051,12923093,15629952,11591660,15610857,20200045,11591660,20204714,26704707,27941758,28541183,28798404