SubtiBank SubtiBank
lysA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lysA

diaminopimelate decarboxylase
locus
BSU_23380
pI
5.01
mw
48.41 kDa
protein length
439 aa Sequence Blast
gene length
1317 bp Sequence Blast
function
biosynthesis of lysine
product
diaminopimelate decarboxylase
essential
no
ec
4.1.1.20
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,436,947 → 2,438,266

    Phenotypes of a mutant

  • auxotrophic for lysine [Pubmed|15574923]
  • reduced conjugation of ICEBs1 [Pubmed|25069588]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + meso-2,6-diaminopimelate --> CO2 + L-lysine (according to UniProt)
  • Protein family

  • Orn/Lys/Arg decarboxylase class-II family (single member, according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1HKW] (from ''Mycobacterium tuberculosis'', 42% identity, 61% similarity) [Pubmed|12637582]
  • Expression and Regulation

    Operons

    genes
    [gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    genes
    [gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • 1A615 ( ''lysA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A615&Search=1A615 BGSC]
  • BKE23380 (Δ[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATTCCCTCTTTCT, downstream forward: _UP4_TAAAAGAAAGCGCCGATTTT
  • BKK23380 (Δ[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATTCCCTCTTTCT, downstream forward: _UP4_TAAAAGAAAGCGCCGATTTT
  • References

  • 7934830,15574923,15699190,1903432,8755877,25069588