SubtiBank SubtiBank
mrnC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mrnC

RNase Mini-III
locus
BSU_00950
pI
9.15
mw
16.09 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
maturation of 23S rRNA
product
RNase Mini-III
essential
no
synonyms
yazC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    114,854 115,285

    The protein

    Protein family

  • MrnC RNase family (single member, according to UniProt)
  • Effectors of protein activity

  • [protein|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|RplC] binding to the precursor 23S rRNA stimulates MrnC activity [Pubmed|19154332]
  • Structure

  • [PDB|4OUN] [pubmed|25634891]
  • Expression and Regulation

    Operons

    genes
    [gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]-[gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]-[gene|E5826A99769E2FE45959A9D623D6467A8DDDEB81|cysS]-[gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]-[gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]-[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]
    description
    [Pubmed|7510287]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7510287], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription antitermination, overlaps a transcription terminator upstream of [gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE], in [regulon|T-box|T-box]
  • regulation

  • expression transiently increases in the forespore [Pubmed|22848659]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B883 (yazC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1882 NBRP B. subtilis, Japan]
  • BKE00950 ([gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCGTATCAAATTCAAGCA, downstream forward: _UP4_TTCGGGACGTCAGGGAGGAA
  • BKK00950 ([gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCGTATCAAATTCAAGCA, downstream forward: _UP4_TTCGGGACGTCAGGGAGGAA
  • labs

  • [SW|Ciaran Condon], IBPC, Paris, France [http://www.ibpc.fr/UPR9073/condon/index_en.html Homepage]
  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage]
  • References

  • 19258532,18430137,18363798,8396117,19154332,19880604,25634891,27924926