SubtiBank SubtiBank
yobO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yobO

similar to phage-related pre-neck appendage protein
locus
BSU_19030
pI
5.57
mw
87.55 kDa
protein length
806 aa Sequence Blast
gene length
2421 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,076,206 2,078,626

    The protein

    Structure

  • [PDB|3SUC] (from phage Phi29, 40% identity) [pubmed|19450535]
  • Expression and Regulation

    Operons

    genes
    [gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]-[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • subject to carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A312 (yobO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/312 NBRP B. subtilis, Japan]
  • BKE19030 ([gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAGACACCTCTTT, downstream forward: _UP4_TAGTGGATACGCCGACCAGT
  • BKK19030 ([gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAGACACCTCTTT, downstream forward: _UP4_TAGTGGATACGCCGACCAGT
  • References

  • 20817675,10666464,19450535