SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


F-type ATP-binding cassette protein, allosterically dissociates antibiotics (virginiamycin M, lincomycin) from their ribosomal binding sites
62.57 kDa
protein length
547 aa Sequence Blast
gene length
1644 bp Sequence Blast
dissociation of antibiotics (virginiamycin M, lincomycin) from the ribosome

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    604,736 606,379

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|ABCF ATPase subfamily] [pubmed|30597160]
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 5-200, aa 292-504) (according to UniProt)
  • Structure

  • [PDB|6HA8] [pubmed|30126986]
  • [SW|Localization]

  • cytoplasm [pubmed|30597160]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16109936], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|RNA switch|RNA switch]: , in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by virginiamycin M or lincomycin [Pubmed|16109936]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|vmlR]' and '[protein|search|ydgF]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-C159 (expZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05610 ([gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATATCCCTCGCTTTA, downstream forward: _UP4_TGAGGGAGAAAGTTCAAGCG
  • BKK05610 ([gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATATCCCTCGCTTTA, downstream forward: _UP4_TGAGGGAGAAAGTTCAAGCG
  • References


  • 30746819
  • Original publications

  • 10092453,16109936,20525796,24687494,27120414,24389466,30126986,30597160