SubtiBank SubtiBank
qoxD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

qoxD

cytochrome aa3 quinol oxidase (subunit IV)
locus
BSU_38140
pI
5.94
mw
13.55 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
function
respiration
product
cytochrome aa3 quinol oxidase (subunit IV)
essential
no
ec
1.10.3.-
synonyms
ipa-40d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,914,315 3,914,689

    The protein

    Catalyzed reaction/ biological activity

  • 2 quinol + O2 --> 2 quinone + 2 H2O (according to UniProt)
  • Protein family

  • cytochrome c oxidase bacterial subunit 4 family (with [protein|28E5AF86CE49D7B0ECBFAF9ED5C1FC65D9F810EA|CtaF], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|qoxA]-[gene|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|qoxB]-[gene|CD4520EF427AEFDCF028AE063BC373FA6DCE379E|qoxC]-[gene|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD]
    description
    [Pubmed|1316894]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA binding, in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • the presence of an iron-responsive element bound by [SW|CitB] between ''[SW|feuA]'' and ''[SW|feuB]'' suggests iron-dependent regulation by [SW|CitB] [Pubmed|10468622]
  • view in new tab

    Biological materials

    Mutant

  • BKE38140 ([gene|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGTTCAGCAGATTTGTTTG, downstream forward: _UP4_TAATACAAAAAACCCTCTTC
  • BKK38140 ([gene|03335DC50CED7B38E2380640AE108ADA09A2CBDF|qoxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGTTCAGCAGATTTGTTTG, downstream forward: _UP4_TAATACAAAAAACCCTCTTC
  • References

  • 11073895,1316894,20351111,10551842,10468622,27503613