SubtiBank SubtiBank
yabP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yabP

required for [SW|sporulation] at a late stage
locus
BSU_00600
pI
6.34
mw
11.26 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
function
[SW|sporulation]
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    68,216 68,518

    The protein

    Structure

  • [PDB|3IPF] (from Desulfitobacterium hafniense, 45% identity)
  • [SW|Localization]

  • forespore outer membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM]-[gene|52D48F22CB53421EE30970D34B4861E2F8A5893D|yabN]-[gene|B0CB19A3E3E84E12BF42BB050394C8A059A89359|yabO]-[gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,11283287], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|12207695], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • expressed during sporulation ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|11283287]
  • view in new tab

    genes
    [gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]-[gene|4DEDB27C0162409571AB4A1BB17CFE400764AE45|yabQ]-[gene|FE0E60B875E72AEF5174A89C7AE5556FF59B19D5|divIC]-[gene|8EDB1BCEEE64FDAF1C9054300751FCB420658865|yabR]
    description
    [Pubmed|11283287]

    regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|11283287]
  • additional information

  • there are about 50,000 molecules of DivIC per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/9426141 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B917 (yabP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1916 NBRP B. subtilis, Japan]
  • BKE00600 ([gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCAGCCCCCATAT, downstream forward: _UP4_AAATGACGCTGACGACACAA
  • BKK00600 ([gene|035B5486A3887FC71ACC0A8FB43ED77DC44E12EA|yabP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCAGCCCCCATAT, downstream forward: _UP4_AAATGACGCTGACGACACAA
  • References

  • 11283287,10869437,15231775