SubtiBank SubtiBank
cspR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

cspR

similar to tRNA (Um34/Cm34) methyltransferase
locus
BSU_08930
pI
6.05
mw
18.44 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
translation
product
tRNA (Um34/Cm34) methyltransferase homolog
essential
no
ec
2.1.1.-
synonyms
ygaR,trmL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    970,135 970,617

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • catalyzes the methyl transfer from S-adenosyl-L-methionine to tRNA(Leu)(CAA) and tRNA(Leu)(UAA) isoacceptors [Pubmed|23804755]
  • cytidine34 in tRNA + S-adenosyl-L-methionine --> 2'-O-methylcytidine34 in tRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • 5-carboxymethylaminomethyluridine34 in tRNALeu + S-adenosyl-L-methionine --> 5-carboxymethylaminomethyl-2'-O-methyluridine34 in tRNALeu + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • class IV-like SAM-binding methyltransferase superfamily (with [protein|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|YacO] and [protein|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|YsgA], according to UniProt)
  • Structure

  • [PDB|4JAK] (from ''E. coli'', 45% identity, 72% similarity) [Pubmed|23804755]
  • Expression and Regulation

    Operons

    genes
    [gene|506BD8F55C235CCCF5045073AEC93D8B1E4FB8DF|yhbB]-[gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • ''[SW|yhbB]-[SW|cspR]'': expressed in the mother cell early during [SW|sporulation] ([SW|SigE]) [Pubmed|12662922]
  • view in new tab

    genes
    [gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]
    description
    [Pubmed|22383849]

    regulation

  • ''[SW|yhbB]-[SW|cspR]'': expressed in the mother cell early during [SW|sporulation] ([SW|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials

    Mutant

  • BKE08930 ([gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCTGTTTTTCTTATCC, downstream forward: _UP4_TAGTGAAAAACCCGCTCATC
  • BKK08930 ([gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCTGTTTTTCTTATCC, downstream forward: _UP4_TAGTGAAAAACCCGCTCATC
  • References

  • 23804755,12662922,22383849,28189581