SubtiBank SubtiBank
yfiI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfiI

similar to oxidoreductase
locus
BSU_08280
pI
5.10
mw
43.42 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    902,506 903,687

    The protein

    Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG], [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|YrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX]
  • Structure

  • [PDB|3DTY] (from Pseudomonas syringae, 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]-[gene|8DA8F976B846665FA9E6BD0FF86FE1F58CCFD260|yfiH]-[gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C299 (yfiI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2297 NBRP B. subtilis, Japan]
  • BKE08280 ([gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCATTTAGCATCATGAAAA, downstream forward: _UP4_TAAATGAGGGAATGCGCCGC
  • BKK08280 ([gene|03BE6DA854612B3F6741E0E167AB310F0DE96285|yfiI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCATTTAGCATCATGAAAA, downstream forward: _UP4_TAAATGAGGGAATGCGCCGC