SubtiBank SubtiBank


arginine decarboxylase, required for [SW|biofilm formation]
53.42 kDa
protein length
490 aa Sequence Blast
gene length
1470 bp Sequence Blast
spermidine, polyamine biosynthesis
arginine decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Metabolism of polyamines]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    1,534,279 → 1,535,751

    Phenotypes of a mutant

  • no [SW|biofilm formation] [Pubmed|24529384,20876533]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + L-arginine --> agmatine + CO2 (according to UniProt)
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (together with [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|YaaO]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|YaaO]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2X3L] (from Staphylococcus aureus, 28% identity) [pubmed|20419351]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • CS210 (''[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG, downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
  • BKK14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG, downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
  • References

  • 24529384,19255484,9723923,20876533,27197833,20419351