SubtiBank SubtiBank
rnr
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rnr

RNase R, required for protection against paraquate stress
locus
BSU_33610
pI
5.70
mw
88.56 kDa
protein length
779 aa Sequence Blast
gene length
2340 bp Sequence Blast
function
nonspecific degradation of rRNA
product
exoribonuclease RNase R (EC 3.1.-.-)
essential
no
synonyms
yvaJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.5|Biosynthesis/ acquisition of nucleotides/ other]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.1|Exoribonucleases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,451,863 3,454,202

    The protein

    Catalyzed reaction/ biological activity

  • 3'-5'-exoribonuclease
  • Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
  • Protein family

  • RNR ribonuclease family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|S1 domain] (aa 628-708) (according to UniProt)
  • 2 [SW|CSD domain]s (aa 73-133, aa 138-202) (according to the Interpro database)
  • Structure

  • [PDB|5XGU] (from E. coli, 40% identity) [pubmed|29036353]
  • Expression and Regulation

    Operons

    genes
    [gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]-[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A495 (yvaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/495 NBRP B. subtilis, Japan]
  • BKE33610 ([gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATTATCCGACCTCCTG, downstream forward: _UP4_TAGCAGCTCAACCAGCAAAT
  • BKK33610 ([gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATTATCCGACCTCCTG, downstream forward: _UP4_TAGCAGCTCAACCAGCAAAT
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers%20Laboratories%20and%20Programs/Bechhofer%20Laboratory?citype=Physician&ciid=Bechhofer%20David%20H%201255565 Homepage]
  • References

    Reviews

  • 25878039,30340785,31464530
  • Original publications

  • 15805528,15805522,20360175,17369301,23529473,22582280,29873764,29036353