SubtiBank SubtiBank
degS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

degS

two-component sensor kinase for exoenzyme and competence regulation, kinase activity is activated in response to inhibition of flagellar rotation
locus
BSU_35500
pI
5.99
mw
44.80 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
function
regulation of degradative enzyme and genetic competence
product
two-component sensor kinase
essential
no
synonyms
sacU

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,645,379 3,646,536

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, autodephosphorylation, phosphorylation of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] on Asp-56 [Pubmed|1901568]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • aa 12 ... 170: unknown DegS domain
  • aa 180 ... 248: HisKA_3 domain (autophosphorylation)
  • aa 289 ... 384: HATPase_c
  • Modification

  • phosphorylation on Ser-76 [Pubmed|17218307], this stimulates phosphotransfer from His-189 to [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|21304896], the phosphorylyation is performed by [protein|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|PrkD] ''in vitro'' [Pubmed|21304896]
  • autophosphorylation on His-189
  • Effectors of protein activity

  • [protein|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|DegQ] (stimulation of autophosphorylation) [Pubmed|21965392]
  • inhibition of flagellar rotation stimulates kinase activity [Pubmed|23888912]
  • Structure

  • [PDB|3GIG] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK], corresponds to the HisKA_3 and HATPase_c domains, 28% identity) [pubmed|19805278]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]-[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]
    description
    [Pubmed|1688843]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1688843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|18502860], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|23123903], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|24317403], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|23123903]
  • view in new tab

    Biological materials

    Mutant

  • BKE35500 ([gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCCCTCCGTCACG, downstream forward: _UP4_TGACTATGATTTGTAAAATA
  • BKK35500 ([gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCCCTCCGTCACG, downstream forward: _UP4_TGACTATGATTTGTAAAATA
  • labs

  • [SW|Tarek Msadek], Institut Pasteur, Paris, France
  • References

    Reviews

  • 23927648
  • Original Publications

  • 17850253,12471443,14563871,1459944,1901568,10094672,1688843,16479537,17218307,21304896,21965392,24296669,23888912,25433860,19805278