SubtiBank SubtiBank
ywkF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywkF

sporulation protein
locus
BSU_36990
pI
8.94
mw
9.93 kDa
protein length
gene length
288 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,795,870 3,796,157

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|59E6468FD891F5271F38543515867B0B4625768D|prfA]-[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]-[gene|04C5876C267D77E59F57A3E7EA19C36FD35A03EF|ywkF]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|04C5876C267D77E59F57A3E7EA19C36FD35A03EF|ywkF]
    description
    [Pubmed|9353933]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A207 (ywkF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/207 NBRP B. subtilis, Japan]
  • BKE36990 ([gene|04C5876C267D77E59F57A3E7EA19C36FD35A03EF|ywkF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACATCCCCTTTGC, downstream forward: _UP4_TTGTTTTAATAAAAAAGGAA
  • BKK36990 ([gene|04C5876C267D77E59F57A3E7EA19C36FD35A03EF|ywkF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACATCCCCTTTGC, downstream forward: _UP4_TTGTTTTAATAAAAAAGGAA
  • References

  • 9353933