SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


O-succinylhomoserine lyase (L-cysteine, H2S, methanethiol, elimination)
41.55 kDa
protein length
373 aa Sequence Blast
gene length
1119 bp Sequence Blast
biosynthesis of methionine
O-succinylhomoserine lyase (L-cysteine, H2S, methanethiol, elimination)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,258,492 → 1,259,613

    The protein

    Catalyzed reaction/ biological activity

  • L-cysteine + O-acetyl-L-homoserine --> acetate + H+ + L,L-cystathionine (according to UniProt)
  • hydrogen sulfide + O-acetyl-L-homoserine --> acetate + L-homocysteine (according to UniProt)
  • Protein family

  • trans-sulfuration enzymes family (with [protein|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|MccB] and [protein|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|MetC], according to UniProt)
  • Paralogous protein(s)

  • [protein|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|MetC], [protein|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|MccB]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|4L0O] (from Helicobacter pylori, 48% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11832514], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|S-box|S-box]: transcription termination/ antitermination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination, in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B298 (yjcI::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A941 ( ''metI''::''spec''), [Pubmed|11832514], available at [ BGSC]
  • BKE11870 (Δ[gene|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|metI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGCTGACACCTTCCC, downstream forward: _UP4_CAGGTCAAAGAGGGAGCTGT
  • BKK11870 (Δ[gene|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|metI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGCTGACACCTTCCC, downstream forward: _UP4_CAGGTCAAAGAGGGAGCTGT
  • References

  • 19258532,11832514,10094622,11948165,12107147,18039762,28701520,29794222,32209653