SubtiBank SubtiBank
ndoAI
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ndoAI

antitoxin, antagonist for [protein|2E5A557E417CB355331CC0555D46A79793EB90B3|EndoA]
locus
BSU_04650
pI
6.14
mw
10.41 kDa
protein length
gene length
282 bp Sequence Blast
function
inhibition of [protein|2E5A557E417CB355331CC0555D46A79793EB90B3|EndoA]
product
antitoxin
essential
no
synonyms
ydcD,mazE

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • Gene

    Coordinates
    518,657 518,938

    The protein

    Protein family

  • mazE/ndoAI family (single member, according to UniProt)
  • Structure

  • [PDB|4ME7] ([protein|2E5A557E417CB355331CC0555D46A79793EB90B3|NdoA]-[protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|NdoAI] complex) [Pubmed|24120662]
  • Expression and Regulation

    Operons

    genes
    [gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
    description
    [Pubmed|15882409]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|ndoA]' [PubMed|20525796]
  • view in new tab

    genes
    [gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr]-[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE04650 ([gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACATACACCTCCAC, downstream forward: _UP4_CGCTTAGTCAGCGGAGGATA
  • BKK04650 ([gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCCCTTTTTCTCAATTG, downstream forward: _UP4_TAACCGCCAAAGGCCAAACA
  • References

  • 17416361,15882409,24120662,23736285