SubtiBank SubtiBank
yfjO

yfjO

similar to ribosomal RNA methyltransferase
locus
BSU_08020
pI
9.81
mw
51.97 kDa
protein length
466 aa Sequence Blast
gene length
1401 bp Sequence Blast
function
unknown
product
putative rRNA methyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    873,402 874,802

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|RlmCD]
  • [SW|Domains]

  • [SW|TRAM domain] (aa 11-69) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|5XJ1] (from Streptococcus pneumoniae, 35% identity) [pubmed|28949991]
  • Expression and Regulation

    Operons

    genes
    [gene|82CDC97D16426016CA7E75240C1A6D0D600F4375|yfjP]-[gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C276 (yfjO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2274 NBRP B. subtilis, Japan]
  • BKE08020 ([gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCTCTCCGTTTC, downstream forward: _UP4_TAAAAAGAACATTTCCCAGT
  • BKK08020 ([gene|05392BB2C32B0405799D4F34E5BA55FC936AB943|yfjO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCTCTCCGTTTC, downstream forward: _UP4_TAAAAAGAACATTTCCCAGT
  • References

  • 21824914,28949991