SubtiBank SubtiBank
yczN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yczN

putative toxin
locus
BSU_03789
pI
5.28
mw
3.70 kDa
protein length
gene length
114 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    430,356 430,469

    The protein

    Protein family

  • [SW|SscA family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]-[gene|2420C171CBDDC4EC695759EBD2D20CB151C3F73D|yczM]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE03789 ([gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03789 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGTTTCACCTCCCTA, downstream forward: _UP4_TAAGCTGCTGACCGTCTCTG
  • BKK03789 ([gene|056F20E9D11BFB7A7EB15281902E8A8870BC6CFF|yczN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03789 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGTTTCACCTCCCTA, downstream forward: _UP4_TAAGCTGCTGACCGTCTCTG
  • References

  • 20156992