SubtiBank SubtiBank
melD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

melD

[SW|ABC transporter] subunit for melibiose and raffinose (permease)
locus
BSU_30280
pI
9.08
mw
34.01 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
uptake of melibiose and raffinose
product
[SW|ABC transporter] (permease)
essential
no
synonyms
amyD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.21|Utilization of melibiose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,099,123 3,100,034

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 30% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|melR]-[gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538,31138628], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]: repression, [pubmed|31138628], in [regulon|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR regulon]
  • regulation

  • induced by melibiose or raffinose ([protein|58276E6FEF9388BBC7FB79BB5A3A1EF3C3DA5BD5|MelR]) [pubmed|31138628]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|22900538,31138628]
  • there is an additional RNA "upshift" signal in front of the [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE] gene suggestive of a [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE]-[gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]-[gene|4E766839240C8F7D56D87DF9E7B99350A83B5FF7|melC]-[gene|CDE9EF9CFB799794D525F12DEC8C4190C6298575|melA] mRNA [Pubmed|22383849]. However, there is no promoter in front of [gene|C3D7C64AD0E58BF326257E23136466A237138B50|melE], suggesting that this mRNA may be the product of mRNA processing [pubmed|31138628]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A799 (amyD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/799 NBRP B. subtilis, Japan]
  • BKE30280 ([gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCACATGAACGTCCCTTG, downstream forward: _UP4_AAAAGAAAGGAGACGGAAAT
  • BKK30280 ([gene|05BFEA711D82395A55B505E5A38286BE2F570350|melD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCACATGAACGTCCCTTG, downstream forward: _UP4_AAAAGAAAGGAGACGGAAAT
  • References

  • 10092453,22383849,22900538,26235029,31138628