SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to [category|SW 1.2.2|PTS], putative EIIC component
47.48 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,938,307 3,939,641

    The protein

    Protein family

  • [category|SW 1.2.2|PTS], lactose EIIC family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|GmuC], [protein|83A7C160B0301A2B51B65478D99ACB753D67AF74|LicC]
  • [SW|Domains]

  • [SW|PTS EIIC domain] type-3 (aa 8-421) (according to UniProt)
  • Structure

  • [PDB|3QNQ] (EIIC component of diacetylchitobiose specific PTS from ''Bacillus cereus''; 60% identity, 87% similarity) [Pubmed|21471968]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE38390 ([gene|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|ywbA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAAAAACCCCCTTTT, downstream forward: _UP4_TGATAGATGATCAGCCTGTC
  • BKK38390 ([gene|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|ywbA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAAAAACCCCCTTTT, downstream forward: _UP4_TGATAGATGATCAGCCTGTC
  • References

  • 10627040