SubtiBank SubtiBank
ylaB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ylaB

unknown
locus
BSU_14720
pI
4.79
mw
10.70 kDa
protein length
gene length
270 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,543,816 1,544,085

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16501307], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]: sigma factor, [Pubmed|16501307], in [regulon|544344B61A804F367BB726976E0C87B61998490A|YlaC regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16501307], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    Biological materials

    Mutant

  • BKE14720 ([gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATGATTCATAAAGACT, downstream forward: _UP4_ATGACGGTGTGGTTTTATTT
  • BKK14720 ([gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTATGATTCATAAAGACT, downstream forward: _UP4_ATGACGGTGTGGTTTTATTT
  • References

  • 16501307