SubtiBank SubtiBank
sdpB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sdpB

membrane protein, required for [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin maturation
locus
BSU_33760
pI
9.52
mw
37.30 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
maturation of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin
product
unknown
essential
no
synonyms
yvaX

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,464,762 3,465,733

    The protein

    Paralogous protein(s)

  • [protein|81E929FD7F66A996300C8412BE172883C262BD67|YitO]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]-[gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]-[gene|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|sdpC]
    description
    [Pubmed|12817086]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [http://www.ncbi.nlm.nih.gov/sites/entrez/14651647,15687200 PubMed]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A449 (yvaX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/449 NBRP B. subtilis, Japan]
  • BKE33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT, downstream forward: _UP4_TAACATTTAGATAATGGAGA
  • BKK33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT, downstream forward: _UP4_TAACATTTAGATAATGGAGA
  • References

    Reviews

  • 20955377
  • Original Publications

  • 12817086,14651647,15687200,15743949,15687200,17720793,18763711,23687264,21815947,23033921