SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane protein, required for [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin maturation
37.30 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
maturation of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,464,762 3,465,733

    The protein

    Paralogous protein(s)

  • [protein|81E929FD7F66A996300C8412BE172883C262BD67|YitO]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-A449 (yvaX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT, downstream forward: _UP4_TAACATTTAGATAATGGAGA
  • BKK33760 ([gene|073D63E17C8248BE39F331FDE9902E21A34056D5|sdpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATACTATTTTTATTTT, downstream forward: _UP4_TAACATTTAGATAATGGAGA
  • References


  • 20955377
  • Original Publications

  • 12817086,14651647,15687200,15743949,15687200,17720793,18763711,23687264,21815947,23033921