SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


acetyl-CoA C-acyltransferase
40.96 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
fatty acid degradation
acetyl-CoA C-acyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • Gene

    3,368,839 3,370,014

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + acyl-CoA --> 3-oxoacyl-CoA + CoA (according to UniProt)
  • Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|MmgA], [protein|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|YhfS]
  • Structure

  • [PDB|3SS6] (the protein of ''B. anthracis'', 41% identity, 73% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|4787161A022E938A6D58A505D92369F889C7DE04|FadN]'': induced by long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab


    regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR]: activation, [Pubmed|12817086], in [regulon|29A3EC8FB0C763A973273AA14EAEB904847C3002|SdpR regulon]
  • regulation

  • ''[protein|search|fadM]'': induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • MGNA-A603 (yusK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32830 ([gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTGCCTCTTTCATAAGCT, downstream forward: _UP4_TTATGCTAAAGGGGGAAAAA
  • BKK32830 ([gene|07498A0A3CB598A6E388540124A4F56E781C86FA|fadA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTGCCTCTTTCATAAGCT, downstream forward: _UP4_TTATGCTAAAGGGGGAAAAA
  • References

  • 17189250,12817086,17919287