The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywiE

minor cardiolipin synthetase, general stress protein, required for protection against paraquat stress

locus: BSU_37240

pI: 8.38

mw: 58.08 kDa

protein length: 500 aa

gene length: 1503 bp

function: phospholipiid biosynthesis, protection against paraquat stress

product: minor cardiolipin synthetase

essential: no

synonyms

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,821,570 3,823,072

The protein

Catalyzed reaction/ biological activity

• 2 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) --> cardiolipin + glycerol (according to UniProt)

Protein family

• phospholipase D family (with [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE] and [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA], according to UniProt)

Paralogous protein(s)

• [protein|2079B210322F26EEC3CCF55611622FADDB1D1BC7|ClsA], [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE]

[SW|Domains]

• 2 PLD phosphodiesterase domains (aa 237-264, aa 413-440) (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]-[gene|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA]-[gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
  description: [pubmed|22383849]

  sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]

  regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]

Biological materials

Mutant

• MGNA-A553 (ywiE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/553 NBRP B. subtilis, Japan]
• BKE37240 ([gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT
• BKK37240 ([gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCTCTCCAATC, downstream forward: _UP4_TAAGAAAAAAGAAATCTGAT

References

• 14973018,15805528,22582280,16514141