SubtiBank SubtiBank
yfmN
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfmN

unknown
locus
BSU_07410
pI
9.02
mw
5.79 kDa
protein length
gene length
156 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    814,109 814,264

    Biological materials

    Mutant

  • MGNA-C328 (yfmN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2326 NBRP B. subtilis, Japan]
  • BKE07410 ([gene|07B6C61C4348AFA27A9FE15D5EEE4E1597345134|yfmN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAAACGTCCCCTCTA, downstream forward: _UP4_TGACACTTGATGAATTCACA
  • BKK07410 ([gene|07B6C61C4348AFA27A9FE15D5EEE4E1597345134|yfmN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCAAACGTCCCCTCTA, downstream forward: _UP4_TGACACTTGATGAATTCACA