SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


15.22 kDa
protein length
136 aa Sequence Blast
gene length
411 bp Sequence Blast
control of Sig([protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]-[protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]) activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,411,684 3,412,094

    The protein


  • cell membrane [Pubmed|26651345]
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • MGNA-B054 (yvrL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33250 ([gene|07C35D58F6AF97F8E6BB75CF8E8B811BAFAB201B|rsiO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGTTCAGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAACGCATTCCA
  • BKK33250 ([gene|07C35D58F6AF97F8E6BB75CF8E8B811BAFAB201B|rsiO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGGTTCAGCTCCTTATG, downstream forward: _UP4_TAAAAAAAGAACGCATTCCA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 18573182,19047353,26651345