SubtiBank SubtiBank
yurR

yurR

similar to glycine oxidase
locus
BSU_32630
pI
6.27
mw
39.29 kDa
protein length
372 aa Sequence Blast
gene length
1119 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,352,789 3,353,907

    The protein

    Protein family

  • DadA oxidoreductase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1RYI] ([protein|87B5C84B7EE10F60B545CCFEF6A527A546B80432|ThiO],23% identity) [pubmed|15105420]
  • Expression and Regulation

    Operons

    genes
    [gene|07DDC0BED23B30D0BF9273508C62B94D924468F6|yurR]-[gene|5E900FDB04EC45AC1DAEEFDCC342DF91303E502E|yurQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A599 (yurR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/599 NBRP B. subtilis, Japan]
  • BKE32630 ([gene|07DDC0BED23B30D0BF9273508C62B94D924468F6|yurR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCAAACACCTTTTCT, downstream forward: _UP4_TAATAAGTAAGAGCATGACA
  • BKK32630 ([gene|07DDC0BED23B30D0BF9273508C62B94D924468F6|yurR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCAAACACCTTTTCT, downstream forward: _UP4_TAATAAGTAAGAGCATGACA
  • References

  • 21815947,15105420