SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


26.35 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,595,210 1,595,917

    The protein

    Protein family

  • UPF0749 family (with [protein|5CDB49209BDCA86E09D6287DFC16B278D9A71379|YlxW], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, (promoter within [protein|D52FDB5015B10E9B26D7FED5708457890C6EA43D|MurG]) [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8106328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab


    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth [Pubmed|1391053]
  • view in new tab



  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    view in new tab



  • expressed during vegatative growth, then switched off, and again expressed during [SW|sporulation ]in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-B362 (ylxX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15260 ([gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATTTCACCCGCTTT, downstream forward: _UP4_GACTGAAAAGGAGGAGAATT
  • BKK15260 ([gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATTTCACCCGCTTT, downstream forward: _UP4_GACTGAAAAGGAGGAGAATT
  • References

  • 1391053,8106328,8320223,18179421