SubtiBank SubtiBank
yosP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yosP

similar to ribonucleoside-diphosphate reductase (beta subunit)
locus
BSU_20040
pI
6.09
mw
22.51 kDa
protein length
598 aa Sequence Blast
gene length
1798 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
nrdF

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,159,981 2,161,778

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-disulfide + 2'-deoxyribonucleoside 5'-diphosphate + H2O --> [thioredoxin]-dithiol + ribonucleoside 5'-diphosphate (according to UniProt)
  • Protein family

  • ribonucleoside diphosphate reductase small chain family (with [protein|CD2D14FE9C10544E7C350167EBDBD941B898051D|NrdF], according to UniProt)
  • Paralogous protein(s)

  • [protein|CD2D14FE9C10544E7C350167EBDBD941B898051D|NrdF]
  • Structure

  • [PDB|4DR0] ( from Bacillus Subtilis 87% identity)
  • Biological materials

    Mutant

  • BKE20040 ([gene|08B733574DC7B8D044033EBB94124D470A0FBE19|yosP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTACATATACGCCAT, downstream forward: _UP4_TTTACCGAGAAAGGATGTAT
  • BKK20040 ([gene|08B733574DC7B8D044033EBB94124D470A0FBE19|yosP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCCTACATATACGCCAT, downstream forward: _UP4_TTTACCGAGAAAGGATGTAT
  • References

  • 21498918,11470879,16621400,9465078