SubtiBank SubtiBank
comK
The papers of the month are back! Check them out! Link here

comK

competence transcription factor (CTF)
locus
BSU10420
pI
7.67
mw
22.28 kDa
protein length
192 aa Sequence Blast
gene length
576 bp Sequence Blast
function
regulation of [SW|genetic competence] and DNA uptake
product
competence transcription factor (CTF)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,117,109 → 1,117,687

    Phenotypes of a mutant

  • no expression of competence genes, loss of [SW|genetic competence] [Pubmed|7783616]
  • The protein

    Modification

  • phosphorylated on Arg-65, Arg-157, Arg-161, Arg-165, Arg-186, and Arg-191 [Pubmed|22517742]
  • additional information

  • degraded by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] (with [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA] as adaptor protein) [PubMed|9890793]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000023 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]
    description
    [Pubmed|8196543]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8196543], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|11849533], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12586407], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, (autoregulation) [Pubmed|8083168], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P, acts as antagonist of [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok] [Pubmed|22412392], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] has a bistable expression pattern [Pubmed|26110430]
  • expression is reduced in a [gene|search|cwlO ]mutant [pubmed|29553055]
  • view in new tab

    additional information

  • full expression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] requires fully assembled and rotating flagella [pubmed|28800172]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P represses comK expression [pubmed|28800172]
  • Biological materials

    Mutant

  • 1A871 (no resistance), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A871&Search=1A871 BGSC]
  • BKE10420 (Δ[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
  • BKK10420 (Δ[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
  • Expression vector

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • Labs working on this gene/protein

  • [SW|Oscar Kuipers], University of Groningen, The Netherlands
  • [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 19995980,12576575,26110607
  • The [SW|ComK regulon]

  • 11948146,11918817
  • Original Publications

  • 8878039,11849533,17569828,9335269,17560370,12586407,11814663,9108277,9890793,9585513,15819619,10908654,9000055,7746142,8830686,10447896,12028382,8016067,10361283,11703662,12107147,17581123,8016066,17493123,16391071,16436435,12270822,15598897,20300532,12761164,12036071,21085679,22517742,7783616,22412392,8083168,24838881,8196543,26110430,27045827,27920766,28800172,29124898,29553055