SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component sensor kinase, regulation of [gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|search|bceB ]in response to bacitracin, plectasin, mersacidin and actagardine
38.61 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
resistance against toxic peptides
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,112,190 3,113,194

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|C239C155F5452C86BF6C78190BABBBB07A63DF87|BceR]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • [SW|Histidine kinase domain] (aa 121-326) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • binding of [protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|BceB] in the absence of bacitracin inhibits [protein|08F24CA21DC54031F6158AC0C772F3B520E5A849|BceS] autophosphorylation [Pubmed|25118291]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP3218 Δ([gene|C239C155F5452C86BF6C78190BABBBB07A63DF87|bceR]-[gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]-[gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB])::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-A166 (ytsB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30390 ([gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCCGCCTTTCGATAAGGA, downstream forward: _UP4_TGACGAAAATGTCACATGCT
  • BKK30390 ([gene|08F24CA21DC54031F6158AC0C772F3B520E5A849|bceS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCCGCCTTTCGATAAGGA, downstream forward: _UP4_TGACGAAAATGTCACATGCT
  • References


  • 27344142,28152228,29404338
  • Original publications

  • 10094672,18394148,12890034,14651641,21283517,20606066,22964256,21078927,17905982,23687272,25118291,26199330,32955745