SubtiBank SubtiBank
fdhD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fdhD

similar to sulphurtransferase
locus
BSU_36710
pI
6.19
mw
29.14 kDa
protein length
262 aa Sequence Blast
gene length
789 bp Sequence Blast
function
unknown
product
similar to sulphurtransferase
essential
no
synonyms
narQ,narAA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,773,366 3,774,154

    The protein

    Protein family

  • fdhD family (single member, according to UniProt)
  • Structure

  • [PDB|4PDE] (from E. coli, 29% identity) [pubmed|25649206]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|095DAEED5F22A3BC46614C16CC907A2DB9E32C6E|fdhD]-[gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE36710 ([gene|095DAEED5F22A3BC46614C16CC907A2DB9E32C6E|fdhD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCTCTTCCCCTCCGC, downstream forward: _UP4_AGGGAGTAGGAAGGGGCTGT
  • BKK36710 ([gene|095DAEED5F22A3BC46614C16CC907A2DB9E32C6E|fdhD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCTCTTCCCCTCCGC, downstream forward: _UP4_AGGGAGTAGGAAGGGGCTGT
  • References

  • 7860592,25649206