SubtiBank SubtiBank
miaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

miaA

tRNA isopentenylpyrophosphate transferase
locus
BSU_17330
pI
6.00
mw
35.52 kDa
protein length
314 aa Sequence Blast
gene length
945 bp Sequence Blast
function
tRNA modification
product
tRNA isopentenylpyrophosphate transferase
essential
no
ec
2.5.1.8
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,866,389 1,867,333

    Phenotypes of a mutant

  • inactivation of ''[gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]'' reduces sporulation efficiency to 16% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • adenosine37 in tRNA + dimethylallyl diphosphate --> diphosphate + N6-dimethylallyladenosine37 in tRNA (according to UniProt)
  • Protein family

  • IPP transferase family (single member, according to UniProt)
  • Structure

  • [PDB|2QGN] (from ''Bacillus halodurans'', 57% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]-[gene|40D3FE1A512703B090316C31099956DB6A7F515B|hfq]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|61B511C49912F1380AEE18AD300255A435F56F94|ymaF]-[gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]-[gene|40D3FE1A512703B090316C31099956DB6A7F515B|hfq]
    description
    [pubmed|22383849]

    regulation

  • expressed during [SW|sporulation ][Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE17330 ([gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGTATCACTCTCTTT, downstream forward: _UP4_TAATCGAAACTGTATGATAT
  • BKK17330 ([gene|09C9CDA3EA23B751C7135DEDF0FE2563BA69FF1D|miaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGTATCACTCTCTTT, downstream forward: _UP4_TAATCGAAACTGTATGATAT
  • References

    The corresponding gene/ protein in other bacteria

  • 11160115,3045085,9294434,26735940