SubtiBank SubtiBank
yfiS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfiS

similar to multidrug resistance protein
locus
BSU_08380
pI
9.60
mw
44.24 kDa
protein length
417 aa Sequence Blast
gene length
1254 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    912,547 913,800

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yfiSR.html DBTBS]) null

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|15DE8BAFB36296B5842E283C836D600755786397|YfiR]: repression, [pubmed|], in [regulon|15DE8BAFB36296B5842E283C836D600755786397|YfiR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C306 (yfiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2304 NBRP B. subtilis, Japan]
  • BKE08380 ([gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCCTCCTGATT, downstream forward: _UP4_AAAATTGCAGAAAGCAGGCG
  • BKK08380 ([gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCCTCCTGATT, downstream forward: _UP4_AAAATTGCAGAAAGCAGGCG
  • References

  • 16862575