SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cell division protein
20.93 kDa
protein length
184 aa Sequence Blast
gene length
555 bp Sequence Blast
cell division protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • Gene

    3,798,789 3,799,343

    The protein

    Protein family

  • racA family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|HTH merR-type domain] (aa 75-156) (according to UniProt)
  • Structure

  • [PDB|5I44] (RacA-DN complex) [Pubmed|27085804]
  • [PDB|5I41] (DNA-binding domain) [Pubmed|27085804]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|12493822], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|12493822,14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger [SW|sporulation ]([SW|Spo0A]) [Pubmed|12493822,14651647,15687200]
  • view in new tab

    Biological materials


  • MGNA-B655 (ywkC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37030 ([gene|09E9194E82DF199527F414DB0EC15547A71AD25E|racA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCCATACCTCCTTT, downstream forward: _UP4_TAAAGCAAAAAGCTCCCTTA
  • BKK37030 ([gene|09E9194E82DF199527F414DB0EC15547A71AD25E|racA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCCCATACCTCCTTT, downstream forward: _UP4_TAAAGCAAAAAGCTCCCTTA
  • References

  • 27085804,15780934,19478798,12493822,12950914,21630458,14651647,15687200,12493822,23264578