SubtiBank SubtiBank
yueB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yueB

membrane protein, part of the type VII protein secretion system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|YukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|YukC]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|YukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|YueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|YueC], receptor for phage SPPI
locus
BSU_31860
pI
4.30
mw
119.77 kDa
protein length
1076 aa Sequence Blast
gene length
3231 bp Sequence Blast
function
export of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|YukE]
product
part of the type VII protein secretion system, receptor for phage SPPI
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.6|Phage-related functions]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,266,687 3,269,917

    Phenotypes of a mutant

  • resistance to phage SPPI [Pubmed|15576783]
  • loss of secretion of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|YukE] [Pubmed|24798022]
  • The protein

    Catalyzed reaction/ biological activity

  • receptor for phage SPP1 [Pubmed|15576783]
  • required for depolarization of the cytoplasmic membrane upon binding of phage SPP1 [Pubmed|22154073]
  • Protein family

  • EsaA family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|15576783,23861817], localizes preferentially to the cell poles [Pubmed|21705600]
  • exposed to the surface [Pubmed|16481324]
  • cytoplasm (homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|yukC]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|23861817], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|23861817]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A649 (yueB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/649 NBRP B. subtilis, Japan]
  • BKE31860 ([gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCAAGCTTTTTCGTTGTT, downstream forward: _UP4_TGATCGCAGCATGGAAAAGG
  • BKK31860 ([gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCAAGCTTTTTCGTTGTT, downstream forward: _UP4_TGATCGCAGCATGGAAAAGG
  • References

    Reviews

  • 19155186,11973144
  • Original publications

  • 16479537,16481324,15576783,21630458,18487323,17611601,22383849,22171743,21705600,22154073,23861817,24798022,27179995