SubtiBank SubtiBank
yloS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yloS

thiamine pyrophosphokinase
locus
BSU_15800
pI
5.22
mw
23.95 kDa
protein length
214 aa Sequence Blast
gene length
645 bp Sequence Blast
function
thiamine salvage
product
thiamine pyrophosphokinase
essential
no
ec
2.7.6.2
synonyms
thiN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,654,730 1,655,374

    The protein

    Catalyzed reaction/ biological activity

  • ATP + thiamine --> AMP + H+ + thiamine diphosphate (according to UniProt)
  • Protein family

  • thiamine pyrophosphokinase family (single member, according to UniProt)
  • Structure

  • [PDB|3LM8]
  • Expression and Regulation

    Operons

    genes
    [gene|84447F9A6644EA8A7593BB99B2B69D4377E670E2|prpC]-[gene|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC]-[gene|519D4694B2895EE6F0D38D918F52F27734506848|cpgA]-[gene|8103B8539338B77CF51B16B7FA76783ED2319F13|rpe]-[gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B136 (yloS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1135 NBRP B. subtilis, Japan]
  • BKE15800 ([gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGATTCCTTTCTCT, downstream forward: _UP4_TAAGCATGTGCTTTCATTCA
  • BKK15800 ([gene|0ACE023DCD6A6BB5A1827D1D997BDFAC3B168C51|yloS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGATTCCTTTCTCT, downstream forward: _UP4_TAAGCATGTGCTTTCATTCA
  • References

    Reviews

  • 19348578,28031352
  • Original publications

  • 15150256,16291685