SubtiBank SubtiBank
spoVIF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spoVIF

required for spore coat assembly and resistance
locus
BSU_11810
pI
10.20
mw
11.45 kDa
protein length
gene length
255 bp Sequence Blast
function
required for spore coat assembly and resistance
product
unknown
essential
no
synonyms
yjcC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,253,385 1,253,639

    The protein

    [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|995C3D0916A6EDEA5A26227DE4F49747E95D6A40|yjzK]-[gene|E0A83F20B479AFEBB1C1EB3A872536E8B6BA8B83|yjcZ]-[gene|0AE8109ED8CC0F4D778E2FC4FF5BE440FCD2DCD8|spoVIF]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|0AE8109ED8CC0F4D778E2FC4FF5BE440FCD2DCD8|spoVIF]
    description
    [Pubmed|14523132]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|14523132,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerR]) [Pubmed|14523132,15699190,20435725]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B295 (yjcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1294 NBRP B. subtilis, Japan]
  • BKE11810 ([gene|0AE8109ED8CC0F4D778E2FC4FF5BE440FCD2DCD8|spoVIF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCGCCTCCTTTTGG, downstream forward: _UP4_TAAGTGGATGGCCTGGCTGA
  • BKK11810 ([gene|0AE8109ED8CC0F4D778E2FC4FF5BE440FCD2DCD8|spoVIF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCGCCTCCTTTTGG, downstream forward: _UP4_TAAGTGGATGGCCTGGCTGA
  • References

  • 14523132,20435725