SubtiBank SubtiBank
ypbG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypbG

unknown
locus
BSU_22980
pI
6.61
mw
28.41 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,404,249 2,405,028

    The protein

    Structure

  • [PDB|2WDC] (from Thermus thermophilus, corresponds to aa 122 ... 228 of YpbG, 27% identity) [pubmed|19535341]
  • Expression and Regulation

    Operons

    genes
    [gene|0AF09652E1D13C82A4F296EA99132491FF55F45D|ypbG]
    description
    [Pubmed|17434969]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A396 (ypbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/396 NBRP B. subtilis, Japan]
  • BKE22980 ([gene|0AF09652E1D13C82A4F296EA99132491FF55F45D|ypbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCTCCATTCT, downstream forward: _UP4_TAACTTCTAAAAAGCAAAAA
  • BKK22980 ([gene|0AF09652E1D13C82A4F296EA99132491FF55F45D|ypbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCTCCATTCT, downstream forward: _UP4_TAACTTCTAAAAAGCAAAAA
  • References

  • 17434969,19535341