SubtiBank SubtiBank
tpi
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tpi

triose phosphate isomerase, glycolytic/ gluconeogenic enzyme
locus
BSU_33920
pI
4.79
mw
26.88 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
function
enzyme in glycolysis/ gluconeogenesis
product
triosephosphate isomerase
essential
no
ec
5.3.1.1
synonyms
tpiA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,479,405 3,480,166

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate --> dihydroxyacetone phosphate (according to UniProt)
  • Protein family

  • triosephosphate isomerase family (single member,according to UniProt)
  • Modification

  • phosphorylation on Ser-213 [Pubmed|17218307]
  • Effectors of protein activity

  • inhibited by 2-phosphoglycolate (in ''B. stearothermophilus'') [Pubmed|8580851]
  • Structure

  • [PDB|1BTM] (complex with 2-phosphoglycolic acid, Geobacillus stearothermophilus), complex with 2-phosphpoglycolic acid, ''Geobacillus stearothermophilus'' [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=48255 NCBI]
  • [SW|Localization]

  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009,16479537]
  • Additional information

  • extensive information on the structure and enzymatic properties of Tpi can be found at [http://www.proteopedia.org/wiki/index.php/Triose_Phosphate_Isomerase Proteopedia]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR]-[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]-[gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
    description
    [Pubmed|11489127]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11489127], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]: repression, [Pubmed|11489127], in [regulon|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR regulon]
  • regulation

  • expression induced by glycolytic intermediates ([protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR]) [protein|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|CggR] [Pubmed|11489127]
  • the mRNA is processed between [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR] and [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    genes
    [gene|ECF0F2E906BF94F509817752827CA189AFBE53FE|pgk]-[gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]-[gene|C86FB523451AC172A20801829B717E5A5F914211|pgm]-[gene|67651D5D3122A89F57F9E7D49074C82A8990A277|eno]
    description
    [Pubmed|11489127]
    view in new tab

    Biological materials

    Mutant

  • GP700 (cat), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • BKK33920 ([gene|0B5E910DC94463E34ABD393E3A8F20191E4A38B2|tpi]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTCCACTTCCTTAT, downstream forward: _UP4_GTTCAATTATTGGAGGAAGG
  • Expression vectors

  • pGP394 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP89 (N-terminal Strep-tag, for [SW|SPINE], expression in B. subtilis), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • pGP1511 (expression in ''B. subtilis'', in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • References

  • 12850135,11489127,17505547,8021172,17218307,8580851,19193632,21821766,23420519,15378759,24825009,28189581